the sgrna scaffold sequence Search Results


90
GenScript corporation the sgrna scaffold sequence
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
The Sgrna Scaffold Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/the sgrna scaffold sequence/product/GenScript corporation
Average 90 stars, based on 1 article reviews
the sgrna scaffold sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the sgRNA scaffold. (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.

Journal: STAR Protocols

Article Title: Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi

doi: 10.1016/j.xpro.2022.101324

Figure Lengend Snippet: Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the sgRNA scaffold. (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.

Article Snippet: Note: In this work, the sgRNA scaffold sequence was acquired cloned into pUC19 from GenScript, but the sgRNA scaffold can be cloned in any other vector. a. Scaffold sequence: GAATTC CATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT AAGCTT .

Techniques: Knock-Out, CRISPR, In Vitro

Journal: STAR Protocols

Article Title: Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi

doi: 10.1016/j.xpro.2022.101324

Figure Lengend Snippet:

Article Snippet: Note: In this work, the sgRNA scaffold sequence was acquired cloned into pUC19 from GenScript, but the sgRNA scaffold can be cloned in any other vector. a. Scaffold sequence: GAATTC CATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT AAGCTT .

Techniques: Virus, Recombinant, Transfection, Plasmid Preparation, Staining, Expressing, Software, CRISPR, Cytometry